Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ525750
Length 360 bp
Fasta Format > rwhdp17o18
gtcctgtaaatcatcaggcaaaaggggagctacaagcctcattcatacac acttggaaaaccagcgaaaaggagcatgcatcgcgatgtgcggctgttct gggtggagacgagagtttctaaagagcggaaggtttcatttattcaaaac atccagaggagcagctgcccttcgaatgtggatttacgccaggcatgagt aggccaacgccttctcctctgacagctcctgggcggtcgcatccatcttc ttcctcgagaactcatcgatcgggagcccttgaacaattgtccattcacc accactgcacgttactgggaaggagtagataagaccagcaggcacaccgt atgaaccatc
Download
page-top