Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ525239
Length 618 bp
Fasta Format > rwhdp16c01
gacggacacagaagctgacgacatgcagttcattgcacgacaatgaaaca tctctagtcacacattcaccacgcacctactaattgaacagcaaatcgac gacacgacacgacaatagctcgttggagcagatgattaactaactagcag ctgcaatacgactaggatcaccgagctgcaaacttattaaacacacccat cagctggatctaggggttgtagaagacgatcttgatctcgtcgacgccgt ggcacttgccgccggggacggagtgctcgaagcagtggccgccgctgttg cagccggcggtggggcagtggtctttcagggggtggccgtggggggtgat ggagacacggatgggcatgtgcgactgggcggtgctcacctggtaccacg ccccgccgtcgtacccgatgtggaactccgtcaccacggcgtcctgcacc ttcacgcgccccgtccacgancacacgtcgtacgacacgtgggtgccgtg gcggancangaagccanggctgtanangancttgctgttgnccancggct cnataccnangtanangnccttgccncnnangttctgcnccnnnnccttn nnnntcnnnttnnnnnnt
Download
page-top