Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ525185
Length 715 bp
Fasta Format > rwhdp15o20
tagtgcagctctctttancaacacaagaccaggtaagggataacagcacc aaaaatttagagcttgtcctcgaaatcggatagaggggtcatctgctcct tgaggcccttcctcttgcggatatccgtgacgagcgtcgccgactgggtg cctgggtccaaaggatcagaagccatgatgtcccagtggtcaaacacaca ctgggggaaggcctggccggacgtcgcggccctcagggtgcttgagaacc caaaggattcaatgacggggaggtaggccttgatgttgtagagcggggta ccttgcctctgcatctcctcgaacacgtgccctctcttctgattcagaac accatagataccaccaagcgcattctccggggcctggatctcaaccaggt acacaggctccagcagccttggcttggcagtcagctgagaagcataaatg accctcctggccgtgggaatgacctgaccaccacccctgtggatagcatc agtgtggagaacaacatcacagacctcaaagcaaatgccacgcatgttct cctcagccaacgcgccttcctttgacgcccactggaaaccagccacaaca gagtccttgatttcattaagatactgcactcccttacacatgtcgacgac catgttggggccagtcgtctcaggtccaaagcaccaaatcttcttggcaa natcctttgtcccac
Download
page-top