Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ524987
Length 711 bp
Fasta Format > rwhdp15d17
ggtctcataacatccaggtttcaccaaagcttacattaggacagtatgta aggcacaagacagacaccaccaagggcacgatatgcagcgctaacagctg aacagctaaaatatacccagtacgaacaatgcccttaacaaaactcagcc aatactaaaaactgcttggtgtctgaaacagtgatttggatatcaattgt ggaattacttcttcttgatggcagccttggtcaccttggccccggttggg tccttcttctcaacgcccttgatgacaccaacagccacagtctgcctcat gtcacggacagcaaaacgaccaagaggagggtaagtggcaaaggtctcca caaccatgggcttggtgggaatcatcttcactatgccagcatcaccattc ttgaggaacttgggcagggcctccagctccttaccagaccgcctgtcgat cttggtcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagt ccagcactggggcgtagccgttgccaatctgaccagggtggttcatgatg atgacctgggaggtgaagttggctgcctccttggcagggtcatccttgga gttggatgcaacaaacccacgcttcanatccttcacggcaacgttcttga cgttgaanccaacgttgtcaccangaancgcctccnnganagactcatgg tgcatctcaac
Download
page-top