Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ524453
Length 523 bp
Fasta Format > rwhdp13f23
tccagcttgactagcactggtcggggtcacacatgatggcgtacgccact ttatttgtcatcgctacaacgattggtgcatcagctaagcaacgatgatc catctacctattagcataactcttgcatttttcattggccaccaatgccg acgactatgctggcaaatggtgcgttgatggtggagcagtcaggtgagac atacacgttgcacatggttggaagagttctcaataccaatgacctgatca cctccaattgagctggttgttgaggttggatgatgccctgaccctgaacg agctgaaacagtggccgccggatctgcacgccttgtcgttgttcttgctg catgatgatggaatgcacgacactatggatggctgcacactggagctgct gaggaatctgtgccagttgttggcaacattgttgctgcatcacctggcaa tcacttcgtggcaagatcattgatatgagggatgacaccaatgacacagg gttgcattgctgcaagagaaaat
Download
page-top