Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523831
Length 730 bp
Fasta Format > rwhdp11e14
attctacagttacaacagctagtgccataactacgacattgtatggataa atcattgtacacgaataatcacggaactagatagcgacatagtaacaaca atgctctcttgtctttcttcattcctcgcacagagagaagggggctttga agaggattattctataaaaattgctctacagcaggaatcctctaccctca ttgcaaaggaagatccttgtgggtgtacacaactcccttgtcaccgttca ctacttgtccactccctcgcagaatgcaccgagtggttaaaagaccgtcg acgccaacaggtccacgggcatgtatgcgccctgtacttatgccaacctc tgcacctagaccaaagcgagtcccatcacagaaccttgtgcttgcattat ggaacacagcagcactgtcaacttgttgtagaaaagtatccgctgacttc ttatcagttgtgataatacaatctgtgtgtgcacttccataacgatttat atggtcaatcgctgactgcacatcatcaacaaattcgagggtgcatgcca ttgagctatactcatgatgaaatgaatctaccttcggtactttcaatgtg tcatgtgcgacaggcccaccataaataacaactccttctttcgcaagttc catcaataaatcatcaagaccctctgtcttgttcagatctttatgaacaa gcagtgtttccatagcattacacgctgcag
Download
page-top