Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523804
Length 740 bp
Fasta Format > rwhdp11c24
aagcttacattaggacagtatgtaaggcacaagacagacaccaccaaggg cacgatatgcagcgctaacagctgaacagctaaaatatacccagtacgaa caatgcccttaacaaaactcagccaatactaaaaactgcttggtgtctga aacagtgatttggatatcaattgtggaattacttcttcttgatggcagcc ttggtcaccttggccccggttgggtccttcttctcaacgcccttgatgac accaacagccacagtctgcctcatgtcacggacagcaaaacgaccaagag gagggtaagtggcaaaggtctccacaaccatgggcttggtgggaatcatc ttcactatgccagcatcaccattcttgaggaacttgggcagggcctccag ctccttaccagaccgcctgtcgatcttggtcaccagctcagcaaacttga cagcaatgtgtgaggtgtggcagtccagcactggggcgtagccgttgcca atctgaccagggtggttcatgatgatgacctgggaggtgaagttggctgc ctccttggcagggtcatccttggagttggatgcaacaaacccacgcttca natccttcacggcaacgttcttgacgttgaagccaacgttgtcaccanga agcgcctccaggagagactcatggtgcatctcaacggacttgacctcant tgtcanaccantgggaaccaaaggtaacaaccataccang
Download
page-top