Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529126
Length 214 bp
Fasta Format > rwhdp9n09
tagatctttgacacattacagtcggcactggtagcaaaaaggttggaata acagatacccctgacagtcacaaaacgaacagcggaatactttcctacat acgaaccagaccaaaacatacttctgacagacagtctactcgtcctcctg gctgcggagcctggcaagcttgttcgtaaccacgatgtcgagctgagcag cacgctcaacaatg
Download
page-top