Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ528968
Length 689 bp
Fasta Format > rwhdp9e21
tatgtctgacattcccagcgatatggaaaatatagccaagtatctatccg ttttcccgagtcacgatttcaacagcggacgtcttagaaccataacgcaa cgacgggtcgagaacagttcccagatttcatgacaggacggtgacgctgg tacaaaatgcaaatccccactaaaacttattcagctcttggacacttccg aatgactgactgactgactggtataagacgacggtgctagacagactccg ccttggtgtagatccgtacggcgacggccaagcccagtatcgcgaggggg accaagaactggaggatcttgatgacgaactcgggggtcttgtcctggtt gtagtgcggctgcttgggcggcgtgtacttgaccttggtgggtatcgtgg tcgcgtcgatctcaccaacatagtactcatccatcatcgcccgggcggtc gtgctgtgccccgcatcctcaaagtcgtcggtcgcgtccttggcggttga agacagcaagacatcgtcgcctccanggtggtcatcaanaaacttggtca cattgtacaccttgccgccgatgactanccancantcntccttgnaggtg tgcttgncnacctcctcnagggtgaacnccttgccnncnnacnannacnt gnnctcctccntcntcntntntnnnnnnnncnaattcnt
Download
page-top