Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ528612
Length 638 bp
Fasta Format > rwhdp8b06
tccagcttgaactagcactggtcggggtcacacatgatggcgtacgccac tttatttgtcatcgctacaacgattggtgcatcagctaagcaacgatgat ccatctacctattagcataactcttgcatttttcattggccaccaatgcc gacgactatgctggcaaatggtgcgttgatggtggagcagtcaggtgaga catacacgttgcacatggttggaagagttctcaataccaatgacctgatc acctccaattgagctggttgttgaggttggatgatgccctgaccctgaac gagctgaaacagtggccgccggatctgcacgccttgncgnngcncttgct gcatgatgatggaatgcacgacactatggatggctgcacactggagctgc tgaggaatctgtgccagttgttggcaacattgttgctgcatcacctggca atcacttcgtggcaagatcattgatatgagggatgacaccaatgacacag ggttgcattgctgcaagagaaaattcttgcaggggntcatctgttgttgt agagatagctgaatcaacggttgttgttgctgggggaatgattgttgcgg ttgttggggctgcangaattgntgntggggctgnggaa
Download
page-top