Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ528444
Length 691 bp
Fasta Format > rwhdp7h15
atatatctttgtatacccacatgcgggaatcaatttcttcttgatctcta ccaaccaaaatatcacaccaatgaagcggccacctcaggtcatcttgctc tggatttgcctgtgaacatgcacgaggaactccacataggaaaggccacc cggtgctttgtcctcgaccaacagcgaacggaagaaatctccagatgggt cgccctttcggcacagtctcagtctcaagtaagagcatctctgtcgcctt atttcattcacaacttcatttactttcctggacaatgcatgatcaaattg ctccaatgccaacagatttggtgcaccagctaaagatgagaaaccaaata tttgctccagggtggcagggttcaccgcatttccgacataaataaaacca tcctcgccattttccaataaataaatcccatcatcctgtatattctcact attgagagtaaggggatttggaataagggaatcctcatcgtcccttgatg taagatcatggagagcaatcatcctagggaacaccaatggaatggctaat aacacagaaactgaggagacagcagagacccaataggaccgatcatctac tctcccatcattcctcagtcctatgcttttaatcaaggccagagtataca aaggcagaagttttaaagcctccggaagaattaactgtcca
Download
page-top