Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ528208
Length 715 bp
Fasta Format > rwhdp6j20
aaaggggagctacaagcctcattcatacacacttggaaaaccagcgaaaa ggagcatgcatcgcgatgtgcggctgttctgggtggagacgagagtttct aaagagcggaaggtttcatttattcaaaacatccagaggagcagctgccc ttcgaatgtggatttacgccaggcatgagtaggccaacgccttctcctct gacagctcctgggcggtcgcatccatcttcttcctcgagaactcatcgat cgggagcccttgaacaattgtccattcaccaccactgcacgttactggga aggagtagataagaccagcaggcacaccgtatgaaccatcagagtacaca cccatggaaacaaatgttccctcagcggttcccagaacccagtcacggat gtgatcacaagctgagctggcagcagagagagcactggagagcttcctcg ctttgatgattgcagcaccacgctgctggacagtggcaatgaactcccca tttagccattcatcatcttgaacaagttcacgaacaggcttctctccact gggagtcttcacagtggcatggttaacatcaggatactgactggacgagt gattaccccagataatagcattcttaacgtcagaaacttggacaccaagt ctctcagaaatctgaccgagtgccctgttgtggtctaggcgggtcaaaca actgatgttcttctc
Download
page-top