Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ527947
Length 660 bp
Fasta Format > rwhdp5l04
ggatatatcagggactcagaaaaccaaacaatgatactggtaagcgggac gcccaaacgggccacagctccgaaggcagatagatcagtacttgtagtcc ttgacgtggaggctctcagaggcgccctcgccaagggtggcgtcgccctt gtaggtgccaagggtggcctcggagttggccttgcacctcaccaggaacg ccgtcctggccttctcctcgttctccgtcttgccggaccaggccttgagg gtgctctgctggagggcacgcccgaaggagaaggacaggttccagggctt cttggtctggagcttgttcatggcgttcaggttcagggtcgcctcctcct cactctgtccaccggagaggaagacaatggcggggacggcagcagggacg gtcctctggagggtgcggacggtgtactcancaatcacctcangggccac cttcttggcgtcngatccangggtgaccatgttgggcttcanganggtgc cctcaangangacatgctggtcnttnanggccttgtancangcancaang acnatctcantcacntaancacancnnnnaatgtnntnangnccatcnnn nangatctcngntcaannatgnnnaccannccnttctcntnnnanatnat nnnatannna
Download
page-top