Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ527914
Length 205 bp
Fasta Format > rwhdp5j06
tgccatgcaggctaacttataatcatccatgaaaaacaacacactcgaca gttttatgcactcttattcccccatcatcaagcatatggtagatcaggca catgcctcagtactctgcccccagaagtgcaagcatcatatcttcatagt ctctgcttgtttccttggaaacagccttctccagcgggacgctgttcctc ttctg
Download
page-top