Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ527295
Length 713 bp
Fasta Format > rwhdp3f15
atcacgacaaataggtcattaacagcaagacagtaagatagactcatcga tacaaaatagtgcagctctctttaacaacacaatagcaggtatgggataa cagcaccaaaaatttagagcttgtcctcgaaatcggacagaggggtcatc tgctccttgaggcccttcctcttgcggatgtccgtgacgagcgtcgccga ctgggtgccagggtccaaaggatcagaagccatgatgtcccagtggtcaa acacacactgggggaatgcctggccggacgtcgcggccctcagggtgctt gagaacccaaaggactcgatgacagggaggtaggccttgatgttgtagag cggggtaccttgcctctgcatctcctcgaacacgtgccctctcttctgat tcagaacaccatagatgccaccaagtgcattctccagggcctggatctca accaggtacacaggctccagcagccttggcttggcagtgagctgggaagc ataaatgaccctcctggccgtgggaatgacctgaccaccacccctgtgaa tagcatcagtgtggagaacaacatcacagacctcaaagcaaatgccacgc atgttctcctcagccaacgcgccttcctttgacgcccactggaacccagc cacaacagagtccttgatttcattganatactgcactcccttacacatgt caacgaccatgtt
Download
page-top