Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ526425
Length 406 bp
Fasta Format > rwhdp1f18
caaaacagatacagttgctcagcagtttacagcaagattcgagctcgcga gtactcgaatcaagaggccacaacattttcaggccaaggtgttccatctc taacactaggtaaaaacaaatagcgcccgctggtaaaagttcgtcatgac tgcttgtgaagtttgaagccaaaaacccttgggacgtattgctgtgatgg cttctgtggtttcaggtgtgggtatgtcatcaagaagagatgagggaatg tcgtaccaaagtatgctccatcaatgttgccttggtacttggaccttgga tagtgtaaatcttcacattttggacaaaacaccttcactgtgcttgacct aggaatgtctgattgccctgctggaagacagggttgaccacagcagtata cacgag
Download
page-top