Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523705
Length 710 bp
Fasta Format > rwhdp10n16
gtgccccatctggcaacaatcaatcaataccgatagcacaagttcgcatt acctcatacctggacctacatgaactatagacccatcgcccattcagcag taaaccaataactgttttgggtatgctgtagcagataggggcagcacaaa atacaaactagattgatagtttgcaatcctagccagtgaaacaacccctg cgcaagtagattccaccaaacgacatcatctgctttgtgaagggtagcgg gaacaatgccgacatccaaagataaatactctattgatcgacatgaatca tgtttgtaccaccaaatcatgatatccaagtcagaatgcagcctcaaacg gttcacttgttacgctgaacgcatccattctcggttaggtactccacaaa ttcatcaattaggtagggccaagcaccttcttcgtcatagttggataact gtggatcaattgtcttgacaaattccaacagctgagaccatgtgtcccta gagatggctttgttatgcctgacctgtagaaactgacaccagtgatcaat taagggccaatgcctttcagcaaacagcaacctccacattccaatagctg tctccagtggaagggatttctgacccttttccctagcccaagcaaacgca aagttgtatatctcacggaacttattatcgtcctttatctcagctcgcag tgatggaagt
Download
page-top