Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523558
Length 618 bp
Fasta Format > rwhdp10f19
atgattacttgatcagacaagtccttgcacgcagagaagagcagtacacc acaccactgactgtctgcaagcctcgggtaagtgctgaacgttacacacc atctttcagcagacacgtacgggctggcgcacacagcttatcgcgcactg ctaatggatctgttattacagtctaattagtggaaggaggtgttcttgag gtgctctggcgcgtcgtcgaaggagtgcttcctggccatggagaggatgg tcttgtcggcgacgatgaagtaggccatcccggcgacggtggagatgatg agcgcctgcccggttgggttgaggtgcgccctcgcccacggcagcatcct cacgctcgccagggtggggattgcggcggcgacggtggcgacggccgcgg ccttggctcccgccatggcggcctctctggaggagcgcttggcggcggcn agcctctggtcnangtangcangggtcaccgtcnacatcttcncnnnana nanctcnnngncacnanaacccnnngaantnaattactantanctancan ngaanngngnnangnaanatnannannnnnncntcnnnnnnaattcntnn nnnnnnnnnnatncnnta
Download
page-top