Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523556
Length 567 bp
Fasta Format > rwhdp10f16
caagggcataacgacngatcgactgcgatggnacatattactacccatan aacaacattaagcatagaaatttgcaaaacggaggtccagccaaggagag tctctcctctcaaattacttccgttgggcaggctgcagaaatgcaataat gcactgcgtctagttctcaatttctaantagaanataagatgatttagat tcggattttatacaatggccacttgcggatggcatccagaaccagggcaa gaacagaactcggaacncggatagaaggcatcactgcttgaagcgatcat cgggtccacgagcatccttaaattgctccgatatctcctccctcgcttgc ttagctttagatganagttcctctaaagtcctgttggtcctcacagcaaa cctctggaaggcacggttgttggcgaggccctcgacgaggaactcgttga cgacgtaactcagcgccctgctgaagatgccgccgccggccatggcgaaa tggtggagcgcggaaacttcgcgaagggggcggaggcaggcgactggtca attggaacggcgttgtg
Download
page-top