Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523549
Length 554 bp
Fasta Format > rwhdp10f07
tgcacgcagagaagaccagtacactacaccactcactgtctgcaagccta gcctgatctcagataattgctgaacattatactagtgctagtatccttca gcagacacgtgcaggccggcatgcagtttattgcacactgctactaatgg gtctattacagtctaattagtggaaggaggtgttcttgaggtgctccggc gcgtcctcgtaggagtgcttcctggccattgatacgatggtcttgtcggc gacgatgaagtaggccatcccggcgacggtggagatgatgagcgcctgcc cggtggggttgaggtgcgccctcgcccacggcagcatcctcacgctcgcc agggtggggactgcggttgcaacggtggcgacggcggccgccttggctcc cgcaatggctgcctctctggagcagcgcttggcggcggcgagcctttggt cgaggtgggctcgggttacggtacacatcttcncaggancanagcttggt ggcgcgagatcncaaggaaatgaaccggnantacantgaagntntttttt tnna
Download
page-top