Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523538
Length 540 bp
Fasta Format > rwhdp10e14
tgacattaagcaacgatataaggtacacatatcaagcattcaacacanat taanctcaaancatgntcacaagaaaccangcctagctgacatctagtct tagcttccatagtatcaactgaaactaaccacanacatccaagagctang tagacatgggaaggaaacaagttccnngnaaaactagtagcaacatctag agctgcttgatctcagccttcctcttctgccacancctgtccagggagcc atcagcatcaccctgagcacggacaaacccatcagagagcaaaggtggtg aagcggccatcatagaggccattctcatcaacgtgaccaatgttgatctg gacagaggcgtggtccttggccgtgatgatcctgttggtggccgagcact tcctggggatgtagaggtccaccatgtcacccacctcgttctgcatggtg gcggctggtgggngantggcacatcnacagcgacgaaaggangtggcaga gagggacncaccttgatctcttggattcnaggaggcgctg
Download
page-top