Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523528
Length 718 bp
Fasta Format > rwhdp10d23
agtacgagtacaactcttttttcagaaagaaaaacggtccatataatctt tgtatacccacatgcgggaatcgatttcttcttgatctctaccaaccaaa atatcacaccaatgaagcggggccacctcaggtcatcttgctctggattt gcctgtgaacatgcacgaggaactccacataggaaaggccaccaggtgtt ttgtcctcgaccagcagcgaacggaagaaatccccagatgggtcgccctt tcggcagagtctcagtctcaagtaagagcatctctgtcgccttatttcgt tcacaacttcattcactttcctggacaatgcattatcaaattgctccaat gccaacagatttggtgcaccagccaaagatgagaaaccaaatatttgctc cagggtggcagggttcaccgcatttccgacataaataaaaccatcctcgc cattttccaacaaataaatcccatcatcctgtatattctcactattgaga gtaaggggatttggaataagggaatcctcatcatcccttgatgtgagatc atggagagcaatcatcctagggaacaccaatggaatggctaataacacag aaactgaggagacaatagagacccaataggaccggtcgtctactctccca tcattcctcagtcctatgcttttaatcaaggccagagtatacaaaggcag aagttttaaagcctccgg
Download
page-top