Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523526
Length 639 bp
Fasta Format > rwhdp10d20
agctctcacagacatttctaatgtcacttctcgataatttaactaggtac accacggacggatttgttacagtatttctcgcaacgggatacagtatcag gcaaaaccggggacaacacatccaacaaccaactctcgtcttaaccccct cgcaaaatctggcgttggaagctgccttgccaaaacatatttccccctcc cctacctgtctgctgctagcaacactgatgctcagagctcgtccttcaga ggctccgtggcagccggttccgccgccttctcggtcgccgcctgcccggc agtctccttgttcttcttgatgtagtcgacaatctcatcggccgtcctgc cgccctcgtaggagaccttctttccgctgggagtgacgaagtagagggtg gggtaaccctggacatcgaactcactgggcacgtcattcgcggtcgcgtc catcttcgcgatcacaacgtcctcttcgctttgaagggtggcagctgcct cgtcgaggatgggtgctagcttcttgcagtgtccgcaccagggcgcatag aattcaataanaacatttttgccagatttgaagaccacgtcgtgaacgtt gtcagccacaactaccttaacaggctcattgttggcctc
Download
page-top