Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523521
Length 567 bp
Fasta Format > rwhdp10d13
ggcacaataacaaagctctggttccatacgatagtcagcattgtatttat ttcgacaaagagaaaaaaacaaagcacttcttacctaagcttgcagtagt tctagttctcaaaacaccatgatggatagagaatatatgcataaaagtcc acgagaacaacatagggcgactcgagcatagctcttactaacttcctaca cagcgctcttctaccagtcttctctactggtagttcctccctggcccgtc cctgccctcatagggaggaggggcggcgttgctgtagttaccgccacctt ggtagcctgggttaccacctggttggccctggtagtctggtgcaccacca ccatagctaggaccaccgccatggtagggaggaggctggttgccacctgc gaaaggtggcggcgggttgcctcctggcgctccaccctggtatccagggt tgttgctatggtangctgggcctggnccattgtgcatgttgccaccnngg ttaccctggnaaccttggntaccancttgnnanccnngngntggggnncc tcnnnatnnnngnggng
Download
page-top