Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523513
Length 714 bp
Fasta Format > rwhdp10d01
atgtcgatatccataaccaaagagtactctattcgcaacgtaaacatatt tcactctgcagttattagtttacaaatgttctccaggctgccggtctact agcacaaaagcaacatctgtttggtgtaaaacaacacattagaactaatg ctgtaactatgatgtgcaaatgagcaaggaaacaggtgtccacagttaca gttcatgcacagctaaccgatgctgcggaggggtttaaccatgacccgac acagctagaatacaaaattgagagacgcttctttcattattggaaagcat tcaagtaccaggccttttatcacttgagaccgtcgccgagccctgcaggc attcctatgctctgcgctagatcagccatcctttccttcattgcctggac gctcctctggtgtgcatccttgtaggcttcattgaccagctcggagactt tttcagcacccaactccattgcagcttccgtgatttcaacatttataggt tgttggttcccagatagtgtaaccttgattagttcgccttcacaataacc ctcaatctcagtcgctgcaagctccttttgcacccgcacagcctccactt ggacaaccatttgggccttcttcacagtttcataaaggttttgcatattt ccaatgtttccaaagattcctcccctttgatggngcctcgncaccattct catctttctccttc
Download
page-top