Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523511
Length 702 bp
Fasta Format > rwhdp10c23
aaagagttgacagcgataagaatcttgcaaaatatcattcaaacactggg gcgatagattttgctactctcagtacaaagtactttactaattactgtca attgctcaaacagaacaacagccgctccacgcaaacagcgactaacaaga aagggcgacttaaaccttgaagccacggctgttcctcctaccacgagcct tctcaaacttcctacccttggagcgcacatagggcttggtatggctgtgc ggcacaccaggtgctttgccgaagtgcctcaccgcctcacgggcattctt gggtcccctcaacaggatagtgttctccccagttggagcacggagtgcaa gctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctc gctgtctctgtgaacctcagagcggtaaccttcattgctgggacctcttg gatccgcatgtcatctgtgattgtaccaacaaccacagcaatgttcttct cctcctttcccttcatgaagttggagaggcggcgcatggagagcggcggg cggttagtcttgctcatgaagagcctcttgaggatgacggcgttgaactt gctcttggtcctcctcaccangaaacggtanagcttgacnaggancttga ngtanacatcntcngacttgggcgcnacncncttggncctcttgttcctc cc
Download
page-top