Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523510
Length 231 bp
Fasta Format > rwhdp10c22
cttggccttcttggagctcgcactctccttgttatcaaaggtggctttgg tcttctcataatccttcttcttctgttcagccttttccacataaggtgct ttctcctcatcngacatagctctccacttctcacccgccgccttgctcac gttggcgacactcttgttgttggggttctccgcgntgtactgctgcctga actcanacatgaanacnanaaaggcggaggg
Download
page-top