Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523508
Length 591 bp
Fasta Format > rwhdp10c19
gctagcacgccccttggtgacaggagaaaaacagggcagccatgaagtta agaggatctgtacaagacgagcccgcccctttggtgatggggaaaaacac agggcagtcatgaagtgaaaggataacgtcacacaattagtttcagaaga agagttaacacctctaagttgattcaagcactccagtagcagcaaaatgc atgccagtgaccatacaagctatgcaatgcatgttctcatcaacctacaa gtttcatgtcgaatagatggtaccatgttacacaaaatcacaacgatagc atagtgctcgctagcgaaactgcaggtcatcataatttaactgaaaacaa gtaggggtccatctttggttctcgtctttggatgtttgtcttcactggtc ttccttggtaacagactctgcttctacccccttgttgttgtcgccggcaa aaagggcaaatggaatgatgcagagaagtgccatcttggcagttccatgg accacaccatcaatcgtacgtgcgtaggactcgacaagcaacttaaactc atcctcttctggaggttccctcatccttctctctatgtccg
Download
page-top