Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523503
Length 560 bp
Fasta Format > rwhdp10c12
ggcaccatgaggcagatacagcaatgtaaaatcctaacctcttcgaccaa agagactatttgcaagttacaaatcaagcaaagttggtacagatgtatag cagcagcaataaaacatcaaacaacgatcatgaagttcaggaagacatga gcttcaagccattgtccggcattcccattccaccagcgagatcggcatct atttgcgtgtgtggggctggcccagacaactgcttgacccttttcttgtg gcgctttgagcggtagtgatcctcctttacggtctcatccgcgaagtacc gatcgcagtggaggcagtagaactggcccatgccggggaggtcctcgtcg acgggtagcgccttgccctcggaatccttgccctggtcggccagcttgac gagctcgtcgtagacggcgtcgtcggctttgacgaggaacttgccgcggc gcacctgcttgcagttgagacggcgcttcttcaccttgcggtgtgggcac ttgcctcccatctgagcttgctcgcggtggtcggcggcggcggctanggt ttcngctccn
Download
page-top