Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523500
Length 655 bp
Fasta Format > rwhdp10c07
tatcgtttcatttacatgtcatgctgtctacgtagctgcagggtttcaaa tggatggggaaatagcagctcatagtactatgagattactcaatctacgt agaaaatagcagcgcttgcattcttcatatatgtaattgtgagctacaca tctgatcacaggctatcacgaatatgtacatcaatcacaggaaatcacct tcctactatggtgtatgtacattataagtcggggcacacggaagggtaat ttggtgtggtgggaatagctgaagtaatggcataattcgtattcatctaa ggttcgttcaagcactactgaccctgtgtgaataggaagggactttggta tatggtacaatagctgaaatagtagccaagttgctggacctatggtttaa gcactaaaaccattgtgtgtggcactccaggggttggttgggatgctggt gcatgcctgancagccatcttcaccatcgcttcangaaggatgccggcat tgcanatgtttgcaaaggaccgcatgtgcttcattccatactgcnccaac nanccacattgtgattcnnaagcacncnccntanacttganacaactccn nncntcnncannangctcnccnctgngcnaacnnnctttanaaccnttgg accat
Download
page-top