Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523498
Length 598 bp
Fasta Format > rwhdp10c05
gacctcaaaaattagtttcacaaatcgcacacaacttccagtccatggtt cacagatgatttatactgatccgtcataccgatacagaagtagaaactct gtaagcttatgttgtctgctttctgttcgtggccttcgctgtatatacca aacaaccatctgttgctccctccatttgatgcttatgaaatgttcaggga tctgactcttcatggtttccaagctgatggtggtggtgggggtgtcggga acattgggggaactgctgagaagatggtgttcttatcaattgaatatctg ccggtatcgatgtcagctanagaaatcaatgctgcaaccaggccagcatt tgctgcaagagtangctctgtgtaattgtaatttgtgcggatatccttga agccatcatgcttgtcagggccagcaaccattgctccaacgaggatatta nggnttgctttcttanactctctccatttgaaacctcctttgcatccnna cttgacaccgnnatgangnattgatgcccctctgngatgaacacnctngn ngnacttcntnccnaaacccannacnnannnnntcnnnngnggnnncc
Download
page-top