Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523497
Length 652 bp
Fasta Format > rwhdp10c04
gcggtacatcatgagcactctggcaataaccaactcatcacaaacatgtg acgattacgacaacacatcatgcacacacacacaacgaaatccttacgca cgcaggtaacagtgcgtgcttgtacgtacgtagaacctggagaagtagta cgtagtttctccgcaatcgaaatccagccacacataaaaaccagcagatg attaagaaattaaagcacacaacaagtacgtagtggtacttcaaatagcc agtcatgcatgcatgcgtgcgtgcatgaggtatggcggatgcagggtccg gccggctcagttggggcactggaagccggaggggacgttcttgccgcagt tgttgaggacgaggctgagggcgatgggcaaggtcaggttgatgcccaga aggttgaggttcagcgtcgtgcagaggcacagcgccgcctcgaggtccgc cagcccctggatcagcgagcagcacggctgcaccggcgggctccccaggg taaggttcagcagcccgagcacgttcgcgcacacccccagcttcagcgcg tccagagggcactgggtgctgtttccgcccccaccgttgccgccgccacc attgccaccgccaccgtttccgccgccaccattcccaccgccaccgtttc cg
Download
page-top