Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523489
Length 704 bp
Fasta Format > rwhdp10b19
tagcacacatactactaattaacttacaaaacacgaacagagggagtgga ctaacttagctaacacgaaccctcctccctccacatcatccaacaccatg gagcccatgagaagctaccaagtcgcagagaccagacagagagccgaaat agtctcgcaaggacacacacacacactacagggtaaacttaaacaaggga aagaatcgcaaaggaaactaaagacaagccgccaaataattgcacagccg atctcgccttcttcttcctcctgccctcccgtcgccccccgccacttgct acatacgtacggtcgctctcggccctgcgagcttgggccatgctcctcac ttgtactccaggatcatgttgttctcgggcgccaggccgacgcaggccct catgatgttctccagcatcgccctctgcttcgccagggcgttcaccaccg gtgtgccaggaggaaccaggggtgccttggtgaggtagctcaggatggtg gcaaccggatggaaggagtggaacttgtcctctccctcggctttcagctg aatcctggtgctgagctcggccaggagcaccaggtcaaggatgatgggtg cggcgaggagcgagtcctcgcaggtgttgtgcagcacgatggtgctcttg ccccccatgaanatctccgaggtgtactcgtccntggccctcttgctgtc tcca
Download
page-top