Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523486
Length 414 bp
Fasta Format > rwhdp10b15
catcatcatcgtcctggtatctttacaaaccgatcaggggtcaaccagag ccaagtctcagcccatggatgcttagtaatactaagttgcttgctgcaac aaacacaacactcctagctactaccactcctaatttaggccccagcagct aaggtacatgacagtcctcagcccctcctcggccttctccgctgggcgcc tctcggccacggcggacactgaggcaggcagctgcttgttaccctgcgag acgccgctgcggacgttggccttggctgcccggtggatggacctgagcgt gtagttccagcggcagagcccggcctggtccttgagcgcctccacagtgc ccacgctcatcgccaccatccacgatgccttggctggagctgccatggtc tatgcttcttgctg
Download
page-top