Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523483
Length 713 bp
Fasta Format > rwhdp10b10
agggcgcatatcacacggcgctaacagtagcaaaacttaataggcactaa actactagagatctcaaaaagcagacatagacggattcaggtaaacgcct catttcttcttgatggcagccttggtcaccttggcgccagttgggtcctt cttctccacacccttgatgacaccaacagccacagtttgcctcatgtcac ggacagcaaaacgaccaagaggagggtaagtggcaaaggtctccacaacc atgggcttggtgggaatcatcttcactatgccagcatcgccgttcttgag gaacttgggcgcggcctctatctccttaccagatcgcctgtcaatcttgg tcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccagc actggggcgtagccgttgccaatctgaccagggtggttcatgataatgac ctgggaggtgaagttggctgcctccttggcagggtcatccttggagttgg atgcaacaaaaccacgcttcanatccttcacggcaacattcttgacgttg aagcccacgttgtcaccangaagcgcctccagganagactcgtggtgcat ctcaacanacttgacctcanttgtcanaccantgggaccaaaggtaacaa ccataccangcttgatgacaccantctcaacacngccaacangcacantt ccnatgccnccaa
Download
page-top