Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523480
Length 332 bp
Fasta Format > rwhdp10b07
gggagnatnntganncttggttgaaggacggtccgtaaggaagttgcccg tgttctggccatctgcacggtagtagttgttcgcccggctacctggaatg ccagctggaatctgcttggttacatcggcagctgccagtgctggtttctc agcaggtgctggcttcgcagctggtgctgcagcaggctttgcaggctcac catctccaaacaggtaacccagagaactttgaccacctccagcactcccg ccacgactcatcttgacttanatcgggcgccgacgaggggacgggggacg ggggacgaggacgagacaggaggaggcgctcg
Download
page-top