Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523479
Length 573 bp
Fasta Format > rwhdp10b06
tggcatagaaagtaatacatttcaattcctcgtgtcggttttgatggcca gaactgcgaggctaacttattcaatcgtattacaactgcatgcgagctta accagaagcttgaatatacaagtcggattatgtattagtattaaatttcg ctagcatagcatgcagatcggattatgtattgatcatcttgggcaggctc ttaggaggcctggaaagacccaccagcgaacctggacttgagaagttcga ccaccccggcgtccacccggagagccctagtgagcaccggcgtggggatg ggcgggttggagccgaagagcgtgagcggcacgaagacgatgccggggtt ctggctgttgaaggagacgaacatggtggcctcggtgtcgccggcgttga actggaagtgcatgaggccatgcgggatgaggaagttctccccggcgcgc accaccctggagtanagcctgttcccggactcgttgctgccgatgatccc cacgangagctcgcctttcatcacnangccgatctcngtggcncgcggnt ggatgtncnnnnnnnnnnnnnnc
Download
page-top