Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523477
Length 438 bp
Fasta Format > rwhdp10b04
acaggtttccatcacaacaacatggcttggaatgaaaagttctgaaacat atatatagagacacgaaaagcagcggaattatagatgtatgcagattgca gatccagtagaatgtatcatgtatgctcacgtcacggacacatttctagg gaggagagcgacccccacaggccgccgcaggcgagtccgtcagggattaa cggcggcggcgagcggggcttccgccgtcaggcgctcgcagcactcgggg cggtaggagcagcacgcgggaactccgggcacagccctgccctgcacctt cgccgacgcggccatcatcaagaataggcagacctgcacgaggaggaaaa ccagcaaggcacggaggtgacccatcgccatggtctctcgcggttgttgt tttgctagcacaaacagtaacacgagaaggagagggag
Download
page-top