Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523475
Length 409 bp
Fasta Format > rwhdp10a23
aaaaatcctgacaggttcaaccacatagctcccaacattacattccagtc ttgggacatcaaaactctcttaatgggggtaaacaaggagagcctgctaa cagttactaaagcaagatggatagaacattcccgctactagaaaaggcat tgtctggcttgatgcttaaacctcctggacgctcaaacctggtgggaggg actgcttgagcttgttggccttgtcggcgtcgaagacgcagagcgtgtag aggtacctggagcagcgcaccttgaacttgacggcgtccttggtcctctt gatccgcaccgaccgcgcgtccttccggcgcgccgtcagcaggaagtcct tgatctcgtggatctgcttcggcatggtggacgactgtgcgcacccgagg agaaggagg
Download
page-top