Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523473
Length 662 bp
Fasta Format > rwhdp10a21
gcagcagacacaggaagataaccaagggcggccggacagagatccagcag cccaaagagtccacctaaaaccctcctaaaccaaccacggagatctcatc ggacggaccaggggaagacacgacacgacacacgactctcttatttagat cgacgacacgacacgggacacacggggcggcgacgacgacggcgaaaggc gacccgcgcgcgggcggatctagagctggccgcagtcggcgatgaccacc tgcttggagcaggtgccgctgcgggagcccaccttctcgatgttcttgac gacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcga gccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttg ggccccgcgttggccatggagaggatcccgggcttggtgtgcttgtggac gaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgc cgttgccccgggtgaagtcgccgccctggcacatgaagtcggggatcacg cggtggaangcgctgcccttgtantgcancngcttgccgctcttgccnac ncccttctcnncngtgnnnnnnncncgnaanttntccnnnntnnnnnnnn ccnnntnnttnt
Download
page-top