Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523469
Length 693 bp
Fasta Format > rwhdp10a14
gtctcgcaagggacacacacacactcacaccagggtaaacttaaccaggg aaagaaagaatcgcaaaggaaaccgaagacaagccgccaaataattccac agccgatctcgccttcttcttcctcctgccctcccgtcgcccctcgccac ttgctacgtacgtacggtcgctctcgtccccgcgagcttgggccctgctc ctcacttgtactccaggatcatgttgttctcgggcgccaggccgacgcac gccctcatgatgttctccagcatggccctctgcttcgccagggcgttcac caccggcgtgccaggaggaacaaggggtgccttggtgaggtagctcagga tggtggcaaccggatggaaggagtggaacttgtcctctccctcggccttc agctgaatcctggtgctgagctcggccaggagcaccagatcaagaatgat cggtgcggcgaggagcgaatcctcgcaggtgttgtggagcacgatggtgc tcttgccgcccatgaagatctccgaggtgtactcgtccatggccctcttg ctgtctccaacgtatggcacatacttgatcacnacnacgtggtcangatg ttccccgggctcntanaggatancattgctcnanaccatgtcatccacca cnttactcttgganatctccttgnaacngatgtctgcggnnca
Download
page-top