Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ635098
Length 618 bp
Fasta Format > whdp20a14
agtggcagacactcattgaggctcatgtggatgtgaagaccactgacaac tacatgctccgcatgttcaccattggcttcacgaagagacgcccaaacca ggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccgcc gcaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaag gagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaa ggccacctcaagcatcttccccctccagaacgtgtacgtccgcaaggtga agatcctgaaggcccccaagtttgacctggggaagctcatggaggtgcac ggtgactacaaggaggatgttggtgtgaagcttgacaggcctgctgatgg agatgaggtgattcctggagcggaggaggttgctgctgctgagtagaaaa tanaagtcgctattttgctgcttcatatctagaagatgatatatgtgcca cctgggtgtcgtgaactttgtantcagttttgatggctgatttcttgagt acttctgtcnacattcctanccancgttcanttatcttattttgttcntg ttactttctggatggang
Download
page-top