Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ290594
Length 553 bp
Fasta Format > whsl19g22
cacctccgcaagctcgacatggatgtcaccctcgtcaacattacccgggg ctcgatgacggcgctgaggtacaccacccggtcgaccaggatctacatcg tcgtggaggggcgcgacggctacttcgagatggcgtgcccgcacgtctcc agctccggccgttctgaacgccgggagcacgagcaggagcgcgagcgcga acacggacacggcaggagaagcgaggagcgcgggcaggagcacggcagga ggagcgaggaggaggagcacggccacggcggcgagcaggagaaatcgagg ggctacaggcaggtgagggcccagatcaaggtggggtcggtgatcgtgct ccccgcgggccacccggcgacgttcgtggccgggaacgaggggaacctcg ccctgctgtccttcggcgtgggcgccaacaacgacgaggaggtgttcgtg accggcgggaacagcgtgctgaagcagctggacgaggcggccaaggcgct ggcgttcccccagcaggcgagggagctggcggacagggtcatccgcgcgc agc
Download
page-top