Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ634488
Length 712 bp
Fasta Format > whdp18m11
tcgcagcaacaaccattaccactgcaacaaacattatcgcaccaacaaca acaacaacctgtccaacaacaaccacaaccatttccacaacagcaaccat gttcacagcaacaacaaccaccattatcgcagcaacaacaacaacaacaa caacaacaacaacagcaacaacagcaacaacaaccctcgtgccgaattcg gcacgaggctgcaccgtcattgatgcccctggtcaccgtgacttcatcaa gaacatgatcaccggtacctcccaggctgactgtgctgttctcatcatcg actccaccactggtggttttgaggctggtatctccnaggatggccagaca cgtgagcacgccctccttgctttcactcttggagtgaagcagatgatctg ctgctgcaacaagatggacgccaccactcccaagtactcgaaggctcgtt acgaagaaattgttaaggaggtctcttcgtacctgaagaaggtcggctac aaccctgacaaggttcccttcgtccccatctctgggttcgagggtgacaa catgattgagaggtccaccaaccttgactggtacaagggcccaaccctgc ttgaggcacttgaccagatcaacgagcccaagaggccctcagacaagccc ctccgtcttcccctacaggatgtttacaagattggtggcattggaactgt gcctgttggccg
Download
page-top