Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633979
Length 512 bp
Fasta Format > whdp16p19
aaatggcgaggatggttttatttatgtcggaaatgcggtgaaccctgcca ccctggagcaaatatttggtttctcatctttagctggtgcaccaaatctg ttggcattggagcaatttgatcatgcattgtccaggaaagtaaatgaagt tgtgaatgaaataaggcgacagagatgctcttacttgagactgagactgt gccgaaagggcgacccatctggagatttcttccgttcgctgttggtcgag gacaaagcaccgggtggcctttcctatgtggagttcctcgtgcatgttca caggcaaatccagagcaagatgacctgaggtggccgcttcattggtgtga tattttggttggtagagatcaagaagaaattgattcccgcatgtgggtat acaaagattatatggaccgtttttctttctgaaaaaagagttgtactcgt acttaattaccctgtttgtactgagattttcatataaaggctccttcgtg gtaaaaaaaaaa
Download
page-top