Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633740
Length 455 bp
Fasta Format > whdp16c01
tcctcttactcctaaccagcgagtaacactccaagcagccaatggcgttc tccaagcccctggcggctctcctcctcgccgtggcgctggcagcgactgc catgtccgccgccggtcaggatccccaaaactgcaagccgagccgcaagg tgacggtgcagaacctgtgcggcaaggacctctacctcggtatcgagccg ctggccaacagcaagctcctctacagccctggcttcctgctccgccacgg cacccacgtgtcgtacgacgtgtgctcgtggacggggcgcgtgaaggtgc aggacgccgtggtgacggagttccacatcgggtacgacggcggggcgtgg taccangtgagcaccgcccantcgcacatgcccatccgtgtctccatcan cccnnannnncannncntgaaanancantgnnccannnnnnnntgnaana nnnnn
Download
page-top