Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633491
Length 523 bp
Fasta Format > whdp15d17
gaccgccgccgccgcctcctcgtcctctcggtcccctctccttccttcga gtttgcttcagccatgggtaaggagaagactcacatcaacatcgtggtca ttggccacgtcgactctggcaagtcgacgaccactggccacctgatctac aagcttggaggcattgacaagcgtgtgatcgagaggttcgagaaggaagc cgctgaaatgaacaagaggtctttcaagtacgcctgggtgcttgacaagc tcaaggccgagcgtgagagaggtatcaccatcgatattgccctctggaag tttgagacaaccaagtactactgcaccgtcattgatgcccctggtcaccg tgacttcatcaagaacatgatcaccggtacctcccaggctgactgtgctg ttctcatcatcgactccaccactggtggttttgaggctggtatctccaag gatggccaganacgtgagcacgcccctccttgctttcactcttggagtga agcagatgatctgctgctgcaac
Download
page-top