Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633441
Length 569 bp
Fasta Format > whdp15b04
gactggctgaggccattgatgatggtcgcattggcccacgtgatgatcct aaggtgcggtccaagatcctgtctgaggagtttgggtgggacaaggatct tgccaagaagatttggtgctttggacctgagacgactggccccaacatgg tcgtcgacatgtgtaagggagtgcagtatcttaatgaaatcaaggactct gttgtggctggtttccagtgggcgtcaaaggaaggcgcgttggctgagga gaacatgcgtggcatttgctttgaggtctgtgatgttgttctccacactg atgctatccacaggggtggtggtcaggtcattcccacggccaggagggtc atttatgcttctcanctgactgccaagccaaggctgctggagcctgtgta cctggttgagatccangccccggagaatgcgcttggtggtatctatggtg ttctgaatcanaananagggcacgtgttcnanganatgcanangcaangt accccnctctacaacatcaangcctacctccccgtcattnaatcctttgn gttctcaancaccctnagg
Download
page-top