Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633360
Length 652 bp
Fasta Format > whdp14m19
gccctgccgccgccgccgccggagaaggagagggagcagccgcagccatg ggtcgcgtccgcaccaagaccgtgaagaagacctcccgccaggtcatcga gaagtactattctcggatgaccctcgacttccacaccaacaagaaggtgc tcgaggaggtctccatcctccagtcgaagcgcctccgcaacaaggtggcc ggcttcaccacccatctgatgcgccgcatccagcgcggccccgtgcgcgg catctccctcaagctgcaggaggaggagcgtgagcgccgcatggacttcg tgccggagaagtcggcgctcgaggtcgacgagatccgcgtcgacaaggag accatggacatgctggcgttcctcggcatggccgacctccccggcgtcga gcgcgcccccgaagtcacctcctccgccgccccctaccgccagccgttca acgggccccgtggtggcaaccgcgcctangttcctccgcatcgtcntcnt acccctatattatgctttatgtcatttanatctgttacttgtggcaagta atgttttgaactcanancttaanttcnaggtgttttnatctncntatggt gnanatgatctgtttatctcnnnnnttatctnaantnattnnatatatta nt
Download
page-top