Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633309
Length 684 bp
Fasta Format > whdp14j19
cgctcagcccccagacgccgcagcgccgccactccacccgcagcggcaac catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagca aaaagaaggccgtcgatccgttcaccaagaagcagtggtatgacatcaag gcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtgtccag gacacagggtaccaagattgcctcagagggtctgaagcacagggtgttcg aagtatctctagctgatcttcagaacgatgaggaccaggcctacaggaag atcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaactt ctggggcatggacttcaccactgacaagctcaggtctcttgtgaggaagt ggcagacactcattgaggctcatgtggatgtgaagaccactgacaactac atgctccgcatgttcaccattggcttcacgaagagacgcccaaaccaggt gaagcgcacttgctatgcccaagcaagtcagatcanacagatccgccgca agatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggag cttgtgaacaagttcatccctgaggtgattggaaaggagattganaaggc cacctcaagcatcttccccctccanaacgtgtac
Download
page-top